Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092591

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF3 (1)

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Siqi Ma et al.
International journal of molecular medicine, 35(6), 1561-1573 (2015-04-16)
Glioblastomas are highly malignant gliomas that are extremely invasive with high rates of recurrence and mortality. It has been reported that activating transcription factor 3 (ATF3) is expressed in elevated levels in multiple malignant tumors. The purpose of this study
Chun-Chao Chen et al.
European journal of pharmacology, 859, 172542-172542 (2019-07-19)
Nicorandil is an adenosine triphosphate-sensitive potassium channel opener with additional antioxidant properties. Doxorubicin (DOX) is an anticancer drug that exerts oxidation-mediated adverse cardiovascular effects. This study examined the effects of nicorandil on DOX-induced cytotoxicity in human umbilical vein endothelial cells
Shunyan Weng et al.
BMC gastroenterology, 16, 25-25 (2016-02-27)
Hepatocellular carcinoma (HCC) is one of most common and aggressive human malignancies in the world, especially, in eastern Asia, and its mortality is very high at any phase. We want to investigate mechanism of niclosamide inducing cell apoptosis in HCC.
Liugen Gu et al.
Pathology, research and practice, 214(6), 862-870 (2018-05-03)
Intestinal epithelial cell (IEC) apoptosis plays a vital role in the pathogenesis of Crohn's disease (CD), which is an inflammatory bowel disease (IBD). Activating transcription factor 3 (ATF3) modulates apoptosis under stress via regulating the p53 pathway. However, the expression
Genaro Hernandez et al.
Science translational medicine, 12(525) (2020-01-10)
The exocrine pancreas expresses the highest concentrations of fibroblast growth factor 21 (FGF21) in the body, where it maintains acinar cell proteostasis. Here, we showed in both mice and humans that acute and chronic pancreatitis is associated with a loss

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica