Todas as fotos(1)

Documentos Principais

COO/COA

EHU092501

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human TRAF3

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

Nível de qualidade

100

linha de produto

MISSION^®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACATGGACCTGCGCTTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGGAAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGCTATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTTTTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATGCTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGCTTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGT

Ensembl | Número de adesão de ser humano

ENSG00000131323

nº de adesão NCBI

NM_003300

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TRAF3(7187) , TRAF3(7187)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

TRAF3 delays cyst formation induced by NF-κB signaling.

Liping Sun et al.

IUBMB life, 69(3), 170-178 (2017-02-12)

This study aims to investigate the effects of TNF receptors associated factor 3 (TRAF3) on the signaling pathway and expression of downstream products of nuclear factor kappa B (NF-κB) in the epithelial cells of renal ducts in individuals with polycystic

Rh-IFN-α attenuates neuroinflammation and improves neurological function by inhibiting NF-κB through JAK1-STAT1/TRAF3 pathway in an experimental GMH rat model.

Peng Li et al.

Brain, behavior, and immunity, 79, 174-185 (2019-02-04)

Neuroinflammation occurs after germinal matrix hemorrhage (GMH) and induces secondary brain injury. Interferon-α (IFN-α) has been shown to exert anti-inflammatory effects in infectious diseases via activating IFNAR and its downstream signaling. We aimed to investigate the anti-inflammatory effects of Recombinant

TRAF3 mediates neuronal apoptosis in early brain injury following subarachnoid hemorrhage via targeting TAK1-dependent MAPKs and NF-κB pathways.

Yan Zhou et al.

Cell death & disease, 12(1), 10-10 (2021-01-09)

Neuronal apoptosis has an important role in early brain injury (EBI) following subarachnoid hemorrhage (SAH). TRAF3 was reported as a promising therapeutic target for stroke management, which covered several neuronal apoptosis signaling cascades. Hence, the present study is aimed to

MiR-92b-3p ameliorates inflammation and autophagy by targeting TRAF3 and suppressing MKK3-p38 pathway in caerulein-induced AR42J cells.

Hongzhi Sun et al.

International immunopharmacology, 88, 106691-106691 (2020-08-22)

Acute pancreatitis (AP) is an inflammatory disease with high morbidity and mortality. Dysregulation of microRNAs (miRNAs) was involved in human diseases, including AP. However, the effects of miR-92b-3p on AP process and its mechanism remain not been fully clarified. The

Osteoclastic miR-214 targets TRAF3 to contribute to osteolytic bone metastasis of breast cancer.

Jin Liu et al.

Scientific reports, 7, 40487-40487 (2017-01-11)

The role of osteoclastic miRNAs in regulating osteolytic bone metastasis (OBM) of breast cancer is still underexplored. Here, we examined the expression profiles of osteoclastogenic miRNAs in human bone specimens and identified that miR-214-3p was significantly upregulated in breast cancer

Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica