Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092281

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS13A

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCACTGAAGATCCAAGGGTATTTAAAGTAACATATGAAAGTGAGAAAGCAGAGTTAGCAGAGCAAGAAATTGCAGTGGCATTACAAGATGTTGGAATTTCTCTTGTCAACAATTACACGAAGCAAGAAGTAGCCTATATAGGCATTACAAGTTCTGATGTGGTTTGGGAAACAAAGCCCAAGAAGAAGGCAAGATGGAAGCCAATGAGTGTAAAGCACACTGAGAAGTTAGAGAGAGAATTTAAGGAATATACTGAATCTTCTCCTTCAGAAGATAAGGTTATTCAGTTGGACACTAATGTTCCGGTTCGCCTAACCCCTACTGGTCATAACATGAAAATTCTGCAGCCGCATGTAATAGCTCTACGAAGAAATTATCTTCCAGCATTAAAAGTGGAATATAACACATCTGCACATCAATCATC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Willi Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1141-1152 (2016-12-14)
Chorein, a protein encoded by VPS13A (vacuolar protein sorting-associated protein 13A), is defective in chorea acanthocytosis, a rare disease characterized by acanthocytosis of red blood cells and neuronal cell death with progressive hyperkinetic movement disorder, cognitive dysfunction, behavioral abnormalities and
Sandra Muñoz-Braceras et al.
Disease models & mechanisms, 12(2) (2019-02-03)
Members of the VPS13 family are associated with various human diseases. In particular, the loss of function of VPS13A leads to chorea-acanthocytosis (ChAc), a rare neurodegenerative disease without available curative treatments. Autophagy has been considered a promising therapeutic target because
Sabina Honisch et al.
Oncotarget, 6(12), 10309-10319 (2015-04-15)
Chorein encoded by VPS13A (vacuolar protein sorting-associated protein 13A) is defective in chorea-acanthocytosis. Chorein fosters neuronal cell survival, cortical actin polymerization and cell stiffness. In view of its anti-apoptotic effect in neurons, we explored whether chorein is expressed in cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica