Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU091501

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB27A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCACCATCCCCATTAGACCTACGAATAAAGCATCCGGTTCTAAAATTAATTTGTTGCAGCTTTGTAAATATTTCTTTAAGATTCAGCCTGAGAGTTAGGAGAAATATTTCAGAGCCAAAAGTGCCTTATACAACCTTAGCCTATTATAGTAAATCATTCAAGGATTCAGAATTTTGCAGTCACAGAAGAGTGTATTTATTATGTAGAATGAATGAGGGTACTGTCACCTGCCTTAATGTAGGTAGGCCCAGAGTCTTACATTTAAGATCTTACATGCAGTTATAAAACCGCCACAGTCTTCAATCCAGATTTGAAGACTCATGCCATAGGTGACATTCTAAAATACCATTAAAGCCACTTAAATGTTAAATAAGAATATACATGCACATCAGCTCAATGT

Ensembl | Número de adesão de ser humano

ENSG00000069974

nº de adesão NCBI

NM_004580

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RAB27A(5873) , RAB27A(5873)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
TDV
KAV
IHT
OZS
ZWS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dajiang Guo et al.
International journal of cancer, 144(12), 3070-3085 (2018-12-18)
Despite recent advances in targeted and immune-based therapies, advanced stage melanoma remains a clinical challenge with a poor prognosis. Understanding the genes and cellular processes that drive progression and metastasis is critical for identifying new therapeutic strategies. Here, we found
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells
Hye-Jin Boo et al.
Nature communications, 7, 12961-12961 (2016-09-27)
Nicotinic acetylcholine receptors (nAChRs) binding to the tobacco-specific carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) induces Ca2+ signalling, a mechanism that is implicated in various human cancers. In this study, we investigated the role of NNK-mediated Ca2+ signalling in lung cancer formation. We show
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Enyong Dai et al.
Autophagy, 16(11), 2069-2083 (2020-01-11)
KRAS is the most frequently mutated oncogene in human neoplasia. Despite a large investment to understand the effects of KRAS mutation in cancer cells, the direct effects of the oncogenetic KRAS activation on immune cells remain elusive. Here, we report
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica