Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU091111

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2K

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTG

Ensembl | Número de adesão de ser humano

ENSG00000078140

nº de adesão NCBI

NM_005339

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UBE2K(3093) , UBE2K(3093)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
OWU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Eun Il Jeong et al.
Cell death & disease, 7(12), e2573-e2573 (2016-12-30)
Cerebral ischemia/reperfusion (I/R) causes brain damage accompanied by ubiquitin accumulation and impairment of proteasome activity. In this study, we report that E2-25K, an E2-conjugating enzyme, is SUMOylated during oxidative stress and regulates cerebral I/R-induced damage. Knockdown of E2-25K expression protects
Lisa Schmölz et al.
Biochimica et biophysica acta, 1863(8), 919-927 (2018-05-08)
The long-chain metabolites of vitamin E (LCM) emerge as a new class of regulatory metabolites and have been considered as the active compounds formed during vitamin E metabolism. The bioactivity of the LCM is comparable to the already established role
Wen-Bin Gu et al.
Developmental and comparative immunology, 101, 103452-103452 (2019-07-19)
NFIL3 is a transcriptional activator of the IL-3 promoter in T cells. In vertebrates, it has been characterized as an essential regulator of several cellular processes such as immunity response, apoptosis and NK cells maturation. However, the identification and functional

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica