Transfection protocols vary from transfection reagent and cell line. Transfect the cell line of interest with esiRNA following the manufacturer’s instructions for the transfection reagent. esiRNA should be tested in a pilot experiment to validate the best concentration and experimental procedure to use with every cell line. Known transfection conditions used for chemically synthesized siRNA are a good starting point for optimization.
EHU087051
MISSION® esiRNA
targeting human MVP
Faça loginpara ver os preços organizacionais e de contrato
Selecione um tamanho
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00
R$ 1.765,00
Check Cart for Availability
Selecione um tamanho
Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
R$ 1.765,00
Check Cart for Availability
Produtos recomendados
descrição
Powered by Eupheria Biotech
Nível de qualidade
linha de produto
MISSION®
Formulário
lyophilized powder
sequência-alvo de DNAc esiRNA
AAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCG
Ensembl | Número de adesão de ser humano
nº de adesão NCBI
Condições de expedição
ambient
temperatura de armazenamento
−20°C
Descrição geral
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Informações legais
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de classe de armazenamento
10 - Combustible liquids
Ponto de fulgor (°F)
Not applicable
Ponto de fulgor (°C)
Not applicable
Escolha uma das versões mais recentes:
Certificados de análise (COA)
Lot/Batch Number
Não está vendo a versão correta?
Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.
Já possui este produto?
Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.
Hyun Min Lee et al.
Scientific reports, 7(1), 13201-13201 (2017-10-19)
Circulating tumor cells (CTCs) play a major role in the metastasis and recurrence of hepatocellular carcinoma (HCC). Here, we found that major vault protein (MVP) is expressed on the surface of HCC cells and further induced under stressful environments. MVP
Shi Liu et al.
Journal of hepatology, 62(5), 1015-1023 (2014-12-08)
We previously demonstrated that major vault protein (MVP) is a novel virus-induced host factor and its expression upregulates type-I interferon production, leading to cellular antiviral response. However, it remains unclear whether the antiviral function of MVP is impaired during hepatitis
-
How long should I transfect cells with this product?
1 answer-
Helpful?
-
Active Filters
Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.
Entre em contato com a assistência técnica
