Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU076011

Sigma-Aldrich

MISSION® esiRNA

targeting human FCGRT

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTCCTGCTCTTTCTCCTTCCTGGGAGCCTGGGCGCAGAAAGCCACCTCTCCCTCCTGTACCACCTTACCGCGGTGTCCTCGCCTGCCCCGGGGACTCCTGCCTTCTGGGTGTCCGGCTGGCTGGGCCCGCAGCAGTACCTGAGCTACAATAGCCTGCGGGGCGAGGCGGAGCCCTGTGGAGCTTGGGTCTGGGAAAACCAGGTGTCCTGGTATTGGGAGAAAGAGACCACAGATCTGAGGATCAAGGAGAAGCTCTTTCTGGAAGCTTTCAAAGCTTTGGGGGGAAAAGGTCCCTACACTCTGCAGGGCCTGCTGGGCTGTGAACTGGGCCCTGACAACACCTCGGTGCCCACCGCCAAGTTCGCCCTGAACGGCGAGGAGTTCATGAATTTCGACCTCAAGCAG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Huiqin Liu et al.
Journal of controlled release : official journal of the Controlled Release Society, 296, 40-53 (2019-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is a dominantly (~95%) KRAS-mutant cancer that has extremely poor prognosis, in part this is due to its strong intrinsic resistance towards almost all therapeutic agents. PDAC relies heavily on KRAS-transformed metabolism, including enhanced macropinocytosis and
Rafal Swiercz et al.
Oncotarget, 8(2), 3528-3541 (2016-12-16)
Tumor cells rely on high concentrations of amino acids to support their growth and proliferation. Although increased macropinocytic uptake and lysosomal degradation of the most abundant serum protein, albumin, in Ras-transformed cells can meet these demands, it is not understood
Giovanni S Offeddu et al.
Biomaterials, 212, 115-125 (2019-05-22)
Recent therapeutic success of large-molecule biologics has led to intense interest in assays to measure with precision their transport across the vascular endothelium and into the target tissue. Most current in vitro endothelial models show unrealistically large permeability coefficients due

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica