Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU074231

Sigma-Aldrich

MISSION® esiRNA

targeting human NFASC

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AATGCATTTCCAAAGGATGCCTTTCTCGCCATATGCCTCCCCTGGCCCCCAGCCCCTCTGCCTCGGCCTTGTCAGTTGCTGAGCTGGGCTTGGCTCCTTTCTGGAAAATGACAGTATTTTTGGCAGGGAGAAGGTGCGCAGGCCTCCTTGCTGCTCTCTGGTTTGGTTGGGAGGTGTGTTTACCTCTTGCTCCTCATTCCTCCCCTGCCCTTTTCTCTGGAATATCTAAGATGTGAGCTGCATTGACTCTGAAGACGTTTGAGGAACAGGAGTGGGCACTGATAGAAAGGACTTCAACGCCAGTGACTGTGTACCTCCAGCAGAAGAAAATCAGGTGTCTGGTCTTGGGGGCACTGTGCTCACTTCTAGAGAGAAGAAAAAGGCTGGGTTTGGACTTCATGCCTCCTC

Ensembl | Número de adesão de ser humano

ENSG00000163531

nº de adesão NCBI

NM_015090

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NFASC(23114) , NFASC(23114)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chang Hoon Bae et al.
Clinical and experimental otorhinolaryngology, 11(2), 124-132 (2018-01-11)
Clusterin (CLU) is known as apolipoprotein J, and has three isoforms with different biological functions. CLU is associated with various diseases such as Alzheimer disease, atherosclerosis, and some malignancies. Recent studies report an association of CLU with inflammation and immune
T-Y Lin et al.
Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology, 44(11), 1347-1360 (2014-09-27)
Infiltration of fibrocytes (FC) in the airway smooth muscle is a feature of asthma, but the pathological significance is unknown. We sought to explore whether FC modulate the phenotype of airway smooth muscle cells (ASMC) in asthmatic vs. control subjects.
Andrea Martello et al.
EMBO reports, 21(7), e48192-e48192 (2020-04-28)
Autophagy is an essential cellular quality control process that has emerged as a critical one for vascular homeostasis. Here, we show that trichoplein (TCHP) links autophagy with endothelial cell (EC) function. TCHP localizes to centriolar satellites, where it binds and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica