Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU073361

Sigma-Aldrich

MISSION® esiRNA

targeting human PSEN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCCTTTGGCAATTCTTCTTCTCAAGCACTGACACTCATTACCGTCTGTGATTGCCATTTCTTCCCAAGGCCAGTCTGAACCTGAGGTTGCTTTATCCTAAAAGTTTTAACCTCAGGTTCCAAATTCAGTAAATTTTGGAAACAGTACAGCTATTTCTCATCAATTCTCTATCATGTTGAAGTCAAATTTGGATTTTCCACCAAATTCTGAATTTGTAGACATACTTGTACGCTCACTTGCCCCAGATGCCTCCTCTGTCCTCATTCTTCTCTCCCACACAAGCAGTCTTTTTCTACAGCCAGTAAGGCAGCTCTGTCGTGGTAGCAGATGGTCCCATTATTCTAGGGTCTTACTCTTTGTATGATGAAAAGAATGTGTTATGAATCGGTGCTGTCAGCCCTGCTGTCAGACCTTCTTCCACAGCAAATGAGATGTATGCCCAAAGACGG

Ensembl | Número de adesão de ser humano

ENSG00000080815

nº de adesão NCBI

NM_000021

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PSEN1(5663) , PSEN1(5663)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
SNU
FKU
QCS
CQT
EUR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Min-Hong Hsieh et al.
Molecules (Basel, Switzerland), 25(2) (2020-01-17)
Osteosarcoma, which is the most prevalent malignant bone tumor, is responsible for the great majority of bone cancer-associated deaths because of its highly metastatic potential. Although tomatidine is suggested to serve as a chemosensitizer in multidrug-resistant tumors, the anti-metastatic effect
Hongyu Zhang et al.
Frontiers in immunology, 11, 999-999 (2020-06-27)
Objective: Cancer-associated fibroblasts (CAFs) were associated with tumor progression in the tumor microenvironment (TME). However, their immunosuppressive roles in protecting cancer cells from the attack by cytotoxic T lymphocytes (CTLs) are not fully clear. In this study, we investigated whether
Sun-Ok Yoon et al.
Apoptosis : an international journal on programmed cell death, 19(11), 1616-1626 (2014-08-27)
Activating mutations in the NOTCH1 gene are found in over 50 % of T-ALL cases. Since Notch signaling contributes to the leukemia cell survival and growth, targeting Notch signaling using γ-secretase inhibitors (GSI) has been proposed as a molecularly targeted
Hannah Brautigam et al.
Scientific reports, 5, 17042-17042 (2015-11-27)
The presenilin 1 (PSEN1) L271V mutation causes early-onset familial Alzheimer's disease by disrupting the alternative splicing of the PSEN1 gene, producing some transcripts harboring the L271V point mutation and other transcripts lacking exon 8 (PS1(∆exon8)). We previously reported that PS1

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica