Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU065921

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT5

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em01 de junho de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em01 de junho de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAGTGGCTCTTGAAATTGGGGCTGACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTAGCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCTCCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTACCTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCTATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTTTGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCC

Ensembl | Número de adesão de ser humano

ENSG00000100462

nº de adesão NCBI

NM_006109

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRMT5(10419) , PRMT5(10419)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Ações bioquímicas/fisiológicas

PRMTs (protein arginine N-methyltransferases) are responsible for the methylation of arginine residues in histones. PRMT5 causes monomethylation and symmetric dimethylation reactions. It works as an oncogene is some neoplasms and is associated with cell proliferation, inhibition of cell death and regulation of tumor suppressor genes. PRMT5 is also involved in stem cell maintenance by controlling differentiation-associated genes.[1] It is involved in cellular responses, including neurogenesis and myogenesis metabolic events, somatic cell reprogramming, regulation of Golgi apparatus, ribosome biogenesis and neuronal spreading and movements.[2]

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
RXU
MWU
BWU
MSU
IDU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nan Wang et al.
Cell death & disease, 11(10), 864-864 (2020-10-17)
Metastasis is the main cause of laryngeal cancer-related death; its molecular mechanism remains unknown. Here we identify protein arginine methyltransferase 5 (PRMT5) as a new metastasis-promoting factor in laryngeal carcinoma, and explore its underlying mechanism of action in regulating laryngeal
Dongying Chen et al.
Journal of cellular and molecular medicine, 21(4), 781-790 (2016-11-20)
To probe the role of protein arginine methyltransferase 5 (PRMT5) in regulating inflammation, cell proliferation, migration and invasion of fibroblast-like synoviocytes (FLSs) from patients with rheumatoid arthritis (RA). FLSs were separated from synovial tissues (STs) from patients with RA and
Ju-Yeon Jeon et al.
Oncology reports, 40(1), 536-544 (2018-05-12)
Protein arginine methyltransferase 5 (PRMT5) is a protein that catalyzes transfer of methyl groups to the arginine residues of proteins and is involved in diverse cellular and biological responses. While the participation of PRMT5 in cancer progression has been increasingly documented
Myc and Omomyc functionally associate with the Protein Arginine Methyltransferase 5 (PRMT5) in glioblastoma cells.
Mongiardi MP
Scientific Reports, 5, 15494-15494 (2015)
Dai Shimizu et al.
International journal of oncology, 50(2), 381-386 (2017-01-20)
The prognosis of advanced hepatocellular carcinoma (HCC) is dismal. Novel molecular targets for diagnosis and therapy is urgently required. This study evaluated expression and functions of the protein arginine methyltransferase 5 (PRMT5) in HCC. Using HCC cell lines, the expression levels
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica