Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU065291

Sigma-Aldrich

MISSION® esiRNA

targeting human NFAT5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCCTATTGCCGATGCTCAGAACCTTTCCCAGGAAACTCAAGGTTCTCTCTTTCATAGTCCAAATCCTATTGTCCACAGTCAGACTTCTACAACCTCCTCTGAACAAATGCAGCCTCCAATGTTTCACTCTCAAAGTACCATTGCTGTGTTACAGGGCTCTTCAGTTCCTCAAGACCAGCAGTCAACCAACATATTTCTTTCCCAGAGTCCCATGAATAATCTTCAGACTAACACAGTAGCCCAAGAAGCATTTTTTGCAGCACCGAACTCAATTTCTCCACTTCAGTCAACATCAAACAGTGAACAACAAGCTGCTTTCCAACAGCAAGCTCCAATATCACACATCCAGACTCCTATGCTTTCCCAAGAACAGGCACAACCCCCGCAGCAGGGTTTATTTCAGCCTCAGGTGGCCCTGGGCTCCCTTCCACCTAATCCAATGCCTCAAAGCCAACAAGGAACCAT

Ensembl | Número de adesão de ser humano

ENSG00000102908

nº de adesão NCBI

NM_006599

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NFAT5(10725) , NFAT5(10725)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sandrine Herbelet et al.
International journal of molecular sciences, 21(21) (2020-10-30)
Duchenne muscular dystrophy (DMD) is characterized by chronic inflammation and fibrotic tissue production by fibroblasts. The promyogenic factor nuclear factor of activated T-cells 5 (NFAT5) is virtually present in all cells, responding to hyperosmolar or pro-inflammatory stress. In embryogenic fibroblasts
Saseong Lee et al.
Journal of immunology (Baltimore, Md. : 1950), 201(2), 359-370 (2018-05-26)
Fibroblast-like synoviocytes (FLSs) play a key role in the progression of rheumatoid arthritis (RA) as a primary component of invasive hypertrophied pannus. FLSs of RA patients (RA-FLSs) exhibit cancer-like features, including promigratory and proinvasive activities that largely contribute to joint
Sandrine Herbelet et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Glucocorticoids are drugs of choice in Duchenne muscular dystrophy (DMD), prolonging patients' ambulation. Their mode of action at the protein level is not completely understood. In DMD, muscle tissue is replaced by fibrotic tissue produced by fibroblasts, reducing mobility. Nuclear
Moritz Veltmann et al.
PloS one, 11(1), e0147312-e0147312 (2016-01-23)
Although systemic hypertension is a risk factor of age-related macular degeneration, antihypertensive medications do not affect the risk of the disease. One condition that induces hypertension is high intake of dietary salt resulting in increased blood osmolarity. In order to
Wei He et al.
Nature communications, 11(1), 1732-1732 (2020-04-09)
High-salt diets are associated with an elevated risk of autoimmune diseases, and immune dysregulation plays a key role in cancer development. However, the correlation between high-salt diets (HSD) and cancer development remains unclear. Here, we report that HSD increases the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica