Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU065071

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG

Ensembl | Número de adesão de ser humano

ENSG00000150093

nº de adesão NCBI

NM_002211

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ITGB1(3688) , ITGB1(3688)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kathleen Wantoch von Rekowski et al.
Biomolecules, 9(12) (2019-11-30)
Tumor cell binding to the microenvironment is regarded as the onset of therapeutic resistance, referred to as cell adhesion mediated drug resistance (CAM-DR). Here we elucidate whether CAM-DR occurs in ovarian cancer cells and contributes to still-existing cisplatin resistance. Cultivation
Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Rayanah Barnawi et al.
International journal of cancer, 145(3), 830-841 (2019-02-06)
Breast cancer remains the second cause of tumor-related mortality in women worldwide mainly due to chemoresistance and metastasis. The chemoresistance and metastasis are attributed to a rare subpopulation with enriched stem-like characteristics, thus called Cancer Stem Cells (CSCs). We have
Cherine Abou Faycal et al.
British journal of cancer, 118(12), 1596-1608 (2018-05-26)
While lung adenocarcinoma patients can somewhat benefit from anti-angiogenic therapies, patients with squamous cell lung carcinoma (SQLC) cannot. The reasons for this discrepancy remain largely unknown. Soluble VEGF receptor-1, namely sVEGFR1-i13, is a truncated splice variant of the cell membrane-spanning
Asma Boudria et al.
Oncogene, 38(7), 1050-1066 (2018-09-09)
Vascular endothelial growth factor-A (VEGF-A) is highly subjected to alternative pre-mRNA splicing that generates several splice variants. The VEGFxxx and VEGFxxxb families encode splice variants of VEGF-A that differ only at the level of six amino acids in their C-terminal
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica