Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU063231

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC25A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAAGAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAAGAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCTTCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGACTTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATCTCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTTGTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTGAACTTG

Ensembl | Número de adesão de ser humano

ENSG00000164045

nº de adesão NCBI

NM_201567

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDC25A(993) , CDC25A(993)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wenzhe Yin et al.
OncoTargets and therapy, 13, 3689-3701 (2020-05-21)
Colorectal cancer (CRC) is a common malignant tumor in digestive system. Circular RNA (circRNA) circ_0007142 has been identified as an oncogene in CRC. However, the mechanism of circ_0007142 in CRC was rarely reported. The levels of circ_0007142, dedicator of cytokinesis
Yanchao Ma et al.
Journal of Cancer, 11(8), 2158-2170 (2020-03-05)
Colorectal cancer (CRC) is one of the most common malignancies, and chemoresistance is one of the key obstacles in the clinical outcome. Here, we studied the function of B7-H3 in regulating cell cycle-mediated chemoresistance in CRC. The ability of B7-H3
Xiao Gao et al.
Nature communications, 11(1), 3904-3904 (2020-08-09)
A major challenge in chemotherapy is chemotherapy resistance in cells lacking p53. Here we demonstrate that NIP30, an inhibitor of the oncogenic REGγ-proteasome, attenuates cancer cell growth and sensitizes p53-compromised cells to chemotherapeutic agents. NIP30 acts by binding to REGγ
Sarah Bertoli et al.
Oncotarget, 6(35), 38061-38078 (2015-10-31)
We investigated cell cycle regulation in acute myeloid leukemia cells expressing the FLT3-ITD mutated tyrosine kinase receptor, an underexplored field in this disease. Upon FLT3 inhibition, CDC25A mRNA and protein were rapidly down-regulated, while levels of other cell cycle proteins

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica