Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU061351

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4L

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCTGCCACGGACAACTACACCCTTCAGATCAACCCTAATTCAGGCCTCTGTAATGAGGATCATTTGTCCTACTTCACTTTTATTGGAAGAGTTGCTGGTCTGGCCGTATTTCATGGGAAGCTCTTAGATGGTTTCTTCATTAGACCATTTTACAAGATGATGTTGGGAAAGCAGATAACCCTGAATGACATGGAATCTGTGGATAGTGAATATTACAACTCTTTGAAATGGATCCTGGAGAATGACCCTACTGAGCTGGACCTCATGTTCTGCATAGACGAAGAAAACTTTGGACAGACATATCAAGTGGATTTGAAGCCCAATGGGTCAGAAATAATGGTCACAAATGAAAACAAAAGGGAATATATCGACTTAGTCATCCAGTGGAGATTTGTGAACAGGGTCCAGAAGCAGATG

Ensembl | Número de adesão de ser humano

ENSG00000049759

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NEDD4L(23327) , NEDD4L(23327)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kimberly Gomez et al.
Molecular brain, 14(1), 20-20 (2021-01-23)
Voltage-gated sodium channels are key players in neuronal excitability and pain signaling. Functional expression of the voltage-gated sodium channel NaV1.7 is under the control of SUMOylated collapsin response mediator protein 2 (CRMP2). When not SUMOylated, CRMP2 forms a complex with
Yuan Wang et al.
Biochemical and biophysical research communications, 531(4), 581-587 (2020-08-20)
The ubiquitin-proteasome system (UPS) is composed of E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme, and E3 ubiquitin ligase, which play a fundamental role in mediating intracellular protein degradation. Ferroptosis is a non-apoptotic regulated cell death caused by iron accumulation and subsequent
Jonathan R Hughes et al.
Frontiers in cell and developmental biology, 8, 607060-607060 (2020-12-08)
8-Oxoguanine DNA glycosylase (OGG1) is the major cellular enzyme required for the excision of 8-oxoguanine DNA base lesions in DNA through the base excision repair (BER) pathway, and therefore plays a major role in suppressing mutagenesis and in controlling genome
Neil J Grimsey et al.
Cell reports, 24(12), 3312-3323 (2018-09-21)
Ubiquitination is essential for protein degradation and signaling and pivotal to many physiological processes. Ubiquitination of a subset of G-protein-coupled receptors (GPCRs) by the E3 ligase NEDD4-2 is required for p38 activation, but how GPCRs activate NEDD4-2 to promote ubiquitin-mediated
Dong-Eun Lee et al.
Cell death & disease, 11(1), 38-38 (2020-01-22)
In mammals, autophagosome formation is initiated by ULK1 via the posttranslational modification of this protein. However, the precise role of ULK1 ubiquitination in modulating autophagy is unknown. Here, we show that NEDD4L, an E3 ubiquitin ligase, binds ULK1 in pancreatic
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica