Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU054291

Sigma-Aldrich

MISSION® esiRNA

targeting human NNMT

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCT

Ensembl | Número de adesão de ser humano

ENSG00000166741

nº de adesão NCBI

NM_006169

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NNMT(4837) , NNMT(4837)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yanzhong Wang et al.
Breast cancer research : BCR, 21(1), 64-64 (2019-05-19)
Nicotinamide N-methyltransferase (NNMT) is overexpressed in various human tumors and involved in the development and progression of several carcinomas. In breast cancer, NNMT was found to be overexpressed in several cell lines. However, the clinical relevance of NNMT in breast
Yanyan Cui et al.
Molecular carcinogenesis, 59(8), 940-954 (2020-05-06)
Esophageal squamous cell carcinoma (ESCC) is a common malignant tumor with poor prognosis. And different individuals respond to the same drug differently. Increasing evidence has confirmed that metabolism reprogramming was involved in the drug sensitivity of tumor cells. However, the
Yanyan Cui et al.
Molecular and cellular biochemistry, 460(1-2), 93-103 (2019-07-07)
Nicotinamide N-methyltransferase (NNMT) is an important methyltransferase involved in the biotransformation of many drugs and exogenous compounds. Abnormal expression of NNMT protein is closely associated with the onset and progression of many malignancies, but little is known about its role
Bashar M Thejer et al.
BMC molecular and cell biology, 21(1), 26-26 (2020-04-16)
Progesterone receptor membrane component 1 (PGRMC1) is often elevated in cancers, and exists in alternative states of phosphorylation. A motif centered on PGRMC1 Y180 was evolutionarily acquired concurrently with the embryological gastrulation organizer that orchestrates vertebrate tissue differentiation. Here, we

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica