Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU049781

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGTCGAGGAGTGTGACAATGAGAAAGAGTCAAAGGTCGTCCAAGGGCTCTGAGATACTTTTGGAGAAACACAAATTCTGTAACATCAAGTGCTACATCGATGGGCCTTATGGGACCCCCACCCGCAGGATCTTTGCCTCTGAGCATGCCGTGCTCATCGGGGCAGGCATCGGCATCACCCCCTTTGCTTCCATTCTGCAGAGTATCATGTACAGGCACCAGAAAAGAAAGCATACTTGCCCCAGCTGCCAGCACTCCTGGATCGAAGGTGTCCAAGACAACATGAAGCTCCATAAGGTGGACTTTATCTGGATCAACAGAGACCAGCGGTCTTTCGAGTGGTTTGTGAGCCTGCTGACTAAACTGGAGATGGACCAGGCCGAGGAGGCTCAATACGGCCGCTTCCTGGAGCTGCATATGTACATGACATCTGCACTGGGCAAGAATGACATG

Ensembl | Número de adesão de ser humano

ENSG00000137808

nº de adesão NCBI

NM_024505

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NOX5(79400) , NOX5(79400)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
GCU
AQS
CWR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Farhan Rizvi et al.
PloS one, 7(4), e34440-e34440 (2012-04-19)
To determine whether NOX 5 is expressed in rabbit corneal stromal cells (RCSC). NADPH oxidases (NOXes) are enzymes that preferentially use NADPH as a substrate and generate superoxide. Several isoforms of NOXes function as multi-protein complexes while NOX5 and DUOXs
Dan Li et al.
The Journal of pharmacology and experimental therapeutics, 360(1), 14-22 (2016-10-21)
We have shown that NADPH oxidase (NOX)5-S may mediate the acid-induced decrease in cell apoptosis. However, mechanisms of NOX5-S-dependent decrease in cell apoptosis are not fully understood. In this study, we found that silencer-of-death domain (SODD) was significantly increased in
Jie Chen et al.
Signal transduction and targeted therapy, 5(1), 139-139 (2020-08-15)
Reactive oxygen species (ROS) localized at the precise subcellular compartments are essential for regulating the activity of signaling proteins. Furthermore, ROS are master regulators of tumor malignant progression that respond to a diverse set of environmental stress, especially hypoxia. NADPH
Hope K A Gole et al.
PloS one, 9(8), e105337-e105337 (2014-08-22)
NADPH oxidase (NOX) is the primary source of reactive oxygen species (ROS) in vascular smooth muscle cells (SMC) and is proposed to play a key role in redox signaling involved in the pathogenesis of cardiovascular disease. Growth factors and cytokines
S Carnesecchi et al.
Free radical biology & medicine, 84, 22-29 (2015-03-24)
Reactive oxygen species (ROS) are key modulators of apoptosis and carcinogenesis. One of the important sources of ROS is NADPH oxidases (NOXs). The isoform NOX5 is highly expressed in lymphoid tissues, but it has not been detected in any common

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica