Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU047401

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAM

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em20 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em20 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAA

Ensembl | Número de adesão de ser humano

ENSG00000108064

nº de adesão NCBI

NM_003201

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TFAM(7019) , TFAM(7019)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BXU
VLU
UFU
YBU
BIT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hiroya Yamada et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11431-11442 (2019-07-18)
Fructose consumption is rising globally, but maternal high fructose intake might adversely affect offspring. Our previous report demonstrated that excess maternal fructose intake impairs hippocampal function in offspring, indicating that the hippocampi of offspring are highly sensitive to maternal fructose.
Hao Ni et al.
Cancer biology & medicine, 18(1), 139-154 (2021-02-26)
Vascular endothelial growth factor (VEGF), apart from its predominant roles in angiogenesis, can enhance cancer cell proliferation, but its mechanisms remain elusive. The purpose of the present study was therefore to identify how VEGF regulates cancer cell proliferation. VEGF effects
Meng Zhao et al.
Theranostics, 11(4), 1845-1863 (2021-01-08)
Aims: Ischemia-reperfusion injury (IRI)-induced acute kidney injury (IRI-AKI) is characterized by elevated levels of reactive oxygen species (ROS), mitochondrial dysfunction, and inflammation, but the potential link among these features remains unclear. In this study, we aimed to investigate the specific
Xu Jiang et al.
Cancers, 12(2) (2020-02-26)
Mitochondrial transcription factor A (TFAM) is required for mitochondrial DNA replication and transcription, which are essential for mitochondrial biogenesis. Previous studies reported that depleting mitochondrial functions by genetic deletion of TFAM impaired autophagic activities. However, the underlying mechanisms remain largely
A Phillip West et al.
Nature, 520(7548), 553-557 (2015-02-03)
Mitochondrial DNA (mtDNA) is normally present at thousands of copies per cell and is packaged into several hundred higher-order structures termed nucleoids. The abundant mtDNA-binding protein TFAM (transcription factor A, mitochondrial) regulates nucleoid architecture, abundance and segregation. Complete mtDNA depletion

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica