Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU036651

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT5B

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGACGGTGTGATGGAAGTGTTAAAAAAACATCTCAAGCCTCATTGGAATGATGGGGCCATTTTGGGGTTTGTAAACAAGCAACAGGCCCATGACCTACTCATTAACAAGCCAGATGGGACCTTCCTCCTGAGATTCAGTGACTCAGAAATTGGCGGCATCACCATTGCTTGGAAGTTTGATTCTCAGGAAAGAATGTTTTGGAATCTGATGCCTTTTACCACCAGAGACTTCTCCATTCGGTCCCTAGCCGACCGCTTGGGAGACTTGAATTACCTTATCTACGTGTTTCCTGATCGGCCAAAAGATGAAGTATACTCCAAATACTACACACCAGTTCCCTGCGAGTCTGCTACTGCTAAAGCTGTTGATGGATACGTGAAGCCACAGATCAAGCAAGTGGTCCCTGAGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Gabrielle Sueur et al.
Scientific reports, 10(1), 1906-1906 (2020-02-07)
We recently identified the CDC25A phosphatase as a key actor in proliferation and differentiation in acute myeloid leukemia expressing the FLT3-ITD mutation. In this paper we demonstrate that CDC25A level is controlled by a complex STAT5/miR-16 transcription and translation pathway
Dharmalingam Subramaniam et al.
Cell death & disease, 11(2), 149-149 (2020-02-26)
Osteosarcoma (OS) is the most common primary bone tumor that primarily affects children and adolescents. Studies suggested that dysregulation JAK/STAT signaling promotes the development of OS. Cells treated with pimozide, a STAT5 inhibitor suppressed proliferation and colony formation and induced
Sarah Bertoli et al.
Oncotarget, 6(35), 38061-38078 (2015-10-31)
We investigated cell cycle regulation in acute myeloid leukemia cells expressing the FLT3-ITD mutated tyrosine kinase receptor, an underexplored field in this disease. Upon FLT3 inhibition, CDC25A mRNA and protein were rapidly down-regulated, while levels of other cell cycle proteins

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica