Todas as fotos(1)

Documentos

COO/COA

EHU035471

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human PNPLA2

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

Ensembl | Número de adesão de ser humano

ENSG00000177666

nº de adesão NCBI

NM_020376

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PNPLA2(57104) , PNPLA2(57104)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

α2AP regulates vascular alteration by inhibiting VEGF signaling in systemic sclerosis: the roles of α2AP in vascular dysfunction in systemic sclerosis.

Yosuke Kanno et al.

Arthritis research & therapy, 19(1), 22-22 (2017-02-06)

Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP

Reduced expression of adipose triglyceride lipase decreases arachidonic acid release and prostacyclin secretion in human aortic endothelial cells.

Monika Riederer et al.

Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)

Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also

Repression of exogenous gene expression by the retinoic acid target gene G0S2.

Tian Ma et al.

International journal of oncology, 42(5), 1743-1753 (2013-04-03)

The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but

Pigment Epithelium-Derived Factor (PEDF) Receptors Are Involved in Survival of Retinal Neurons.

Susanne Bürger et al.

International journal of molecular sciences, 22(1) (2021-01-06)

The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the

Muscle-specific deletion of comparative gene identification-58 (CGI-58) causes muscle steatosis but improves insulin sensitivity in male mice.

Ping Xie et al.

Endocrinology, 156(5), 1648-1658 (2015-03-10)

Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether

Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica