Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU030271

Sigma-Aldrich

MISSION® esiRNA

targeting human MECP2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em28 de março de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em28 de março de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGTGACCGAGAGAGTTAGCTGACTTTACACGGAGCGGATTGCAAAGCAAACCAACAAGAATAAAGGCAGCTGTTGTCTCTTCTCCTTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAATATTTTTTTTTCTTTCAGTAAACTTAGAGTTTCGTGGCTTCAGGGTGGGAGTAGTTGGAGCATTGGGGATGTTTTTCTTACCGACAAGCACAGTCAGGTTGAAGACCTAACCAGGGCCAGAAGTAGCTTTGCACTTTTCTAAACTAGGCTCCTTCAACAAGGCTTGCTGCAGATACTACTGACCAGACAAGCTGTTGACCAGGCACCTCCCCTCCCGCCCAAACCTTTCCCCCATGTGGTCGTTAGAGACAGAGCGACAGAGCAGTTGAGAGGACACTCCC

Ensembl | Número de adesão de ser humano

ENSG00000169057

nº de adesão NCBI

NM_004992

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MECP2(4204) , MECP2(4204)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
GZT
FST
QCS
AJT
WXS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting
Anja Rogler et al.
Journal of cancer research and clinical oncology, 141(10), 1779-1790 (2015-03-04)
We previously showed that the Wnt-signaling antagonist SFRP1 (secreted frizzled-related protein 1) is a promising marker in bladder cancer. The aim of this study was to validate the prognostic role and analyze the functional significance of SFRP1. Four bladder cancer
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.
Balaram Thota et al.
Journal of neurosurgery, 121(2), 374-383 (2014-06-01)
Insulin-like growth factor binding proteins (IGFBPs) have been implicated in the pathogenesis of glioma. In a previous study the authors demonstrated that IGFBP-3 is a novel glioblastoma biomarker associated with poor survival. Since signal transducer and activator of transcription 1
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica