Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU027341

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCACCGTCACTCTCAAGGATCTCCGTGTAGAACTCCTTGGAGAGACCTCTATTGCTGAGTGCTTGACATACCTTGATAATGGTGTTGTGTTTGTCGGGTCTCGCCTGGGTGACTCCCAGCTTGTGAAGCTCAACGTTGACAGTAATGAACAAGGCTCCTATGTAGTGGCCATGGAAACCTTTACCAACTTAGGACCCATTGTCGATATGTGCGTGGTGGACCTGGAGAGGCAGGGGCAGGGGCAGCTGGTCACTTGCTCTGGGGCTTTCAAGGAAGGTTCTTTGCGGATCATCCGGAATGGAATTGGAATCCACGAGCATGCCAGCATTGACTTACCAGGCATCAAAGGATTATGGCCACTGCGGTCTGACCCTAATCGTGAGACTGATGACACTTTGGTGCTCTCTTTTGTGGGCCAGACAAGAGTTCTCATGTTAAATGGAGAGGAGGTAGAAGAAACCGAACTGATGGGTTTCGTGGATGATC

Ensembl | Número de adesão de ser humano

ENSG00000167986

nº de adesão NCBI

NM_001923

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DDB1(1642) , DDB1(1642)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hiroaki Kawara et al.
Biochemical and biophysical research communications, 519(1), 204-210 (2019-09-09)
The ERCC1-XPF heterodimer is a structure-specific endonuclease and plays multiple roles in various DNA repair pathways including nucleotide excision repair and also telomere maintenance. The dimer formation, which is mediated by their C-terminal helix-hairpin-helix regions, is essential for their endonuclease
Huiming Lu et al.
Nature communications, 8(1), 2039-2039 (2017-12-13)
Pathway choice within DNA double-strand break (DSB) repair is a tightly regulated process to maintain genome integrity. RECQL4, deficient in Rothmund-Thomson Syndrome, promotes the two major DSB repair pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). Here we report
Qiuling Li et al.
The Journal of biological chemistry, 290(35), 21553-21567 (2015-07-15)
Pygopus 2 (Pygo2/PYGO2) is an evolutionarily conserved coactivator and chromatin effector in the Wnt/β-catenin signaling pathway that regulates cell growth and differentiation in various normal and malignant tissues. Although PYGO2 is highly overexpressed in a number of human cancers, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica