Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU024791

Sigma-Aldrich

MISSION® esiRNA

targeting human TET2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCAGCAGCCAATAGGACATGATCCAGGAAGAGCAGTAAGGGACTGAGCTGCTGAATTCAACTAGAGGGCAGCCTTGTGGATGGCCCCGAAGCAAGCCTGATGGAACAGGATAGAACCAACCATGTTGAGGGCAACAGACTAAGTCCATTCCTGATACCATCACCTCCCATTTGCCAGACAGAACCTCTGGCTACAAAGCTCCAGAATGGAAGCCCACTGCCTGAGAGAGCTCATCCAGAAGTAAATGGAGACACCAAGTGGCACTCTTTCAAAAGTTATTATGGAATACCCTGTATGAAGGGAAGCCAGAATAGTCGTGTGAGTCCTGACTTTACACAAGAAAGTAGAGGGTATTCCAAGTGTTTGCAAAATGGAGGAATAAAACGCACAGTTAGTGAACCTTCTCTCTCTGGGCTCC

Ensembl | Número de adesão de ser humano

ENSG00000168769

nº de adesão NCBI

NM_017628

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TET2(54790) , TET2(54790)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Elena F M Manzoni et al.
Scientific reports, 6, 37017-37017 (2016-11-15)
Phenotype definition is controlled by epigenetic regulations that allow cells to acquire their differentiated state. The process is reversible and attractive for therapeutic intervention and for the reactivation of hypermethylated pluripotency genes that facilitate transition to a higher plasticity state.
Juan Peng et al.
Oncotarget, 7(47), 76423-76436 (2016-11-09)
Tet methylcytosine dioxygenase 2 (TET2) mediates the conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC). The loss of TET2 is associated with advanced atherosclerotic lesions. Our previous study showed that TET2 improves endothelial cell function by enhancing endothelial cell autophagy. Accordingly
Zhaocai He et al.
American journal of translational research, 10(10), 3211-3223 (2018-11-13)
To explore the effect of fetal-lethal non-coding developmental regulatory RNA (FENDRR) in the initiation and progression of gastric cancer (GC). We detected the levels of FENDRR, microRNA-214-3p (miR-214-3p), and ten-eleven-translocation (TET2) in GC tissues and GC cell lines. In addition
Peter A Mollica et al.
Journal of cell science, 131(13) (2018-06-15)
Huntington's disease (HD) is a rare autosomal dominant neurodegenerative disorder caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat (TNR) expansion within the HTT gene. The mechanisms underlying HD-associated cellular dysfunction in pluripotency and neurodevelopment are poorly understood. We had previously identified
Juan Peng et al.
Frontiers in pharmacology, 8, 486-486 (2017-08-12)
Ten-eleven translocation-2 (TET2) protein is a DNA demethylase that regulates gene expression through DNA demethylation and also plays important roles in various diseases including atherosclerosis. Endothelial dysfunction represents an early key event in atherosclerotic disease. The cystathionine-γ-lyase (CSE)/hydrogen sulfide (H
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica