Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU018291

Sigma-Aldrich

MISSION® esiRNA

targeting human BCAP31

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shuya Yang et al.
Cancer medicine, 10(1), 305-316 (2020-11-20)
BAP31 (B-cell receptor-associated protein 31) is an important regulator of intracellular signal transduction and highly expressed in several cancer tissues or testicular tissues. Our previous study had revealed that elevated BAP31 plays a crucial role in the progress and metastasis
Shuya Yang et al.
Frontiers in molecular biosciences, 7, 107-107 (2020-06-26)
Cervical cancer (CC) is the most common malignant tumor in gynecology, and metastasis is an important cause of patient death. MiRNAs (microRNAs) have been found to play key roles in cervical cancer metastasis, but the effect of miR-362-3p in CC
Takushi Namba
Science advances, 5(6), eaaw1386-eaaw1386 (2019-06-18)
The endoplasmic reticulum (ER) is composed of large membrane-bound compartments, and its membrane subdomain appears to be in close contact with mitochondria via ER-mitochondria contact sites. Here, I demonstrate that the ER membrane protein, BAP31, acts as a key factor
Won-Tae Kim et al.
Stem cells (Dayton, Ohio), 32(10), 2626-2641 (2014-06-06)
B-Cell receptor-associated protein 31 (BAP31) regulates the export of secreted membrane proteins from the endoplasmic reticulum (ER) to the downstream secretory pathway. Previously, we generated a monoclonal antibody 297-D4 against the surface molecule on undifferentiated human embryonic stem cells (hESCs).

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica