Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em23 de março de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em23 de março de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Ensembl | Número de adesão de ser humano

ENSG00000185591

nº de adesão NCBI

NM_138473

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SP1(6667) , SP1(6667)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PCV
OVT
QCS
UCT
XXS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jie Qi et al.
Journal of diabetes research, 2020, 2308520-2308520 (2020-03-19)
Cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) overexpression results in endothelial apoptosis, thus mediating vascular endothelial injury in hyperglycaemia. E26 transformation-specific sequence transcription factor-1 (ESE-1), which belongs to the E26 transformation-specific family of transcription factors, has been demonstrated
Lili Lv et al.
Oncology research, 26(5), 775-783 (2017-12-16)
Cervical cancer is the third most commonly diagnosed malignancy and the fourth leading cause of cancer-related deaths in women worldwide. MicroRNA-296 (miR-296) is aberrantly expressed in a variety of human cancer types. However, the expression levels, biological roles, and underlying
Jingnan Liu et al.
Human molecular genetics, 25(4), 672-680 (2016-01-09)
Mutations in leucine-rich repeat kinase 2 (LRRK2) cause autosomal-dominant Parkinsonism with pleomorphic pathology including deposits of aggregated protein and neuronal degeneration. The pathogenesis of LRRK2-linked Parkinson's disease (PD) is not fully understood. Here, using co-immunoprecipitation, we found that LRRK2 interacted
Yuehua Zhao et al.
Molecular medicine reports, 16(2), 2191-2198 (2017-06-20)
Research into the expression and function of microRNAs (miRNAs/miR) in human cancer has provided novel insights into the molecular mechanisms underlying carcinogenesis and cancer progression. Aberrant miRNA expression has been reported in retinoblastoma (RB) and several other types of human
Moon-Chang Choi et al.
International journal of molecular sciences, 19(5) (2018-05-12)
Osteoarthritis (OA) is the most common and increasing joint disease worldwide. Current treatment for OA is limited to control of symptoms. The purpose of this study was to determine the effect of specificity protein 1 (SP1) inhibitor Mithramycin A (MitA)
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica