Todas as fotos(1)

Documentos Principais

COO/COA

Visualizar Toda a Documentação

EHU017091

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human RRM1

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

Nível de qualidade

100

linha de produto

MISSION^®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGC

Ensembl | Número de adesão de ser humano

ENSG00000167325

nº de adesão NCBI

NM_001033

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RRM1(6240) , RRM1(6240)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

BWU

VIU

GRR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

High RRM1 Expression Is Associated with Adverse Outcome in Patients with Cisplatin/Vinorelbine-treated Malignant Pleural Mesothelioma.

Zarah Glad Zimling et al.

Anticancer research, 35(12), 6731-6738 (2015-12-08)

A possible predictive impact of ribonucleotide-reductase subunit-1 (RRM1) on vinorelbine efficacy in non-small cell lung cancer (NSCLC) has been previously reported. The present study aimed to further explore this finding in malignant pleural mesothelioma (MPM). Seventy-one patients with MPM receiving

Ribonucleotide Reductase Catalytic Subunit M1 (RRM1) as a Novel Therapeutic Target in Multiple Myeloma.

Morihiko Sagawa et al.

Clinical cancer research : an official journal of the American Association for Cancer Research, 23(17), 5225-5237 (2017-04-27)

Cell-cycle-dependent phosphorylation of RRM1 ensures efficient DNA replication and regulates cancer vulnerability to ATR inhibition.

Zhen Shu et al.

Oncogene, 39(35), 5721-5733 (2020-07-28)

Ribonucleotide reductase (RNR) catalyzes the rate-limiting step of de novo synthesis of deoxyribonucleotide triphosphates (dNTPs) building blocks for DNA synthesis, and is a well-recognized target for cancer therapy. RNR is a heterotetramer consisting of two large RRM1 subunits and two

Quantitative analysis of intracellular nucleoside triphosphates and other polar metabolites using ion pair reversed-phase liquid chromatography coupled with tandem mass spectrometry.

Jianmei Wu et al.

Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)

Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex

Adiponectin attenuates lung fibroblasts activation and pulmonary fibrosis induced by paraquat.

Rong Yao et al.

PloS one, 10(5), e0125169-e0125169 (2015-05-07)

Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the

Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica