Todas as fotos(1)

Documentos

EHU016451

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human PTPN1

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAACAAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACATCAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTCATT

Ensembl | Número de adesão de ser humano

ENSG00000196396

nº de adesão NCBI

NM_002827

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTPN1(5770) , PTPN1(5770)

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Minimally disruptive optical control of protein tyrosine phosphatase 1B.

Akarawin Hongdusit et al.

Nature communications, 11(1), 788-788 (2020-02-09)

Protein tyrosine phosphatases regulate a myriad of essential subcellular signaling events, yet they remain difficult to study in their native biophysical context. Here we develop a minimally disruptive optical approach to control protein tyrosine phosphatase 1B (PTP1B)-an important regulator of

Protein tyrosine phosphatase PTPN1 modulates cell growth and associates with poor outcome in human neuroblastoma.

Caroline E Nunes-Xavier et al.

Diagnostic pathology, 14(1), 134-134 (2019-12-16)

Protein tyrosine phosphatases (PTPs) regulate neuronal differentiation and survival, but their expression patterns and functions in human neuroblastoma (NB) are scarcely known. Here, we have investigated the function and expression of the non-receptor PTPN1 on human NB cell lines and

Protein tyrosine phosphatases PTP-1B, SHP-2, and PTEN facilitate Rb/E2F-associated apoptotic signaling.

Liza D Morales et al.

PloS one, 9(5), e97104-e97104 (2014-05-09)

To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)

Selective deficiency in endothelial PTP1B protects from diabetes and endoplasmic reticulum stress-associated endothelial dysfunction via preventing endothelial cell apoptosis.

Samuel Legeay et al.

Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110200-110200 (2020-05-18)

Diabetes notably increases the risk for endothelial dysfunction, a main precursor for microvascular complications. While endoplasmic reticulum stress (ERS) and protein tyrosine phosphatase 1B (PTP1B) have been associated with endothelial dysfunction in resistance vessels, whether these mechanisms also contribute to

miR-744 enhances type I interferon signaling pathway by targeting PTP1B in primary human renal mesangial cells.

Xiaoyan Zhang et al.

Scientific reports, 5, 12987-12987 (2015-08-12)

Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica