Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU016271

Sigma-Aldrich

MISSION® esiRNA

targeting human JAM3

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAATGACCGCAAGGAAATTGATGAGATTGTGATCGAGTTAACTGTGCAAGTGAAGCCAGTGACCCCTGTCTGTAGAGTGCCGAAGGCTGTACCAGTAGGCAAGATGGCAACACTGCACTGCCAGGAGAGTGAGGGCCACCCCCGGCCTCACTACAGCTGGTATCGCAATGATGTACCACTGCCCACGGATTCCAGAGCCAATCCCAGATTTCGCAATTCTTCTTTCCACTTAAACTCTGAAACAGGCACTTTGGTGTTCACTGCTGTTCACAAGGACGACTCTGGGCAGTACTACTGCATTGCTTCCAATGACGCAGGCTCAGCCAGGTGTGAGGAGCAGGAGATGGAAGTCTATGACCTGAACATTGGCGGAATTATTGGGGGGGTTCTGGTTGTCCTTGCTGTACTGGCCCTGATCACGTTGGGCATCTGCTGTGCATACAGACGTGGCTACTTCATCAACAATAAACAGGATGGAGAAAGTTACAAGAACCCAGGGAAACCAGAT

Ensembl | Número de adesão de ser humano

ENSG00000166086

nº de adesão NCBI

NM_032801

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... JAM3(83700) , JAM3(83700)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xudong Li et al.
International journal of molecular medicine, 42(5), 2923-2929 (2018-09-19)
As a common type of renal cancer, renal cell carcinoma (RCC) has a high annual mortality rate. The incidence of RCC has been increasing in China and worldwide. A large number cases of RCC are diagnosed at late stages, often
SongNan Hao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(6), 5675-5687 (2014-03-04)
This study aims to investigate lymphatic metastasis-related genes in non-small cell lung carcinomas (NSCLC). NSCLC tissue was analyzed for expression of junctional adhesion molecule-C (JAM-C) protein. Our data revealed novel associations between JAM-C overexpression in primary tumors and lymphatic microvessel
Matina Economopoulou et al.
Thrombosis and haemostasis, 114(6), 1241-1249 (2015-08-28)
In proliferative retinopathies, like proliferative diabetic retinopathy and retinopathy of prematurity (ROP), the hypoxia response is sustained by the failure of the retina to revascularise its ischaemic areas. Non-resolving retina ischaemia/hypoxia results in upregulation of pro-angiogenic factors and pathologic neovascularisation

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica