Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU013041

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM4A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACTGCAGGCCAGAAAGTCATTAGCAAGCATAAGAACGGGCGCTTCTACCAGTGTGAAGTGGTCAGGCTCACCACCGAGACCTTCTATGAAGTCAACTTTGATGATGGCTCCTTCAGCGACAATCTTTATCCTGAGGACATAGTGAGCCAGGACTGTCTCCAGTTTGGTCCTCCTGCTGAAGGGGAAGTGGTCCAAGTGAGATGGACAGACGGCCAAGTCTATGGAGCCAAGTTTGTGGCCTCCCACCCTATCCAAATGTACCAGGTGGAGTTTGAGGATGGCTCACAACTTGTGGTTAAGAGAGATGATGTATACACACTGGATGAAGAGCTTCCCAAGAGAGTCAAATCTAGACTGTCAGTAGCCTCAGACATGCGCTTCAATGAGATTTTCACAGAGAAAGAGGTTAAGCAAGAAAAGAAACGGCAA

Ensembl | Número de adesão de ser humano

ENSG00000066135

nº de adesão NCBI

NM_014663

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KDM4A(9682) , JMJD2A(9682)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IJU
IDU
QET
LBT
QQS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Haiyu Zhang et al.
Archives of biochemistry and biophysics, 684, 108334-108334 (2020-03-17)
Emerging evidence shows that histone modification and its related regulators are involved in the progression and chemoresistance of ovarian cancer (OC) cells. Our present study found that the expression of Jumonji C domain-containing 2A (JMJD2A), while not JMJD2B or JMJD2C
Antonio Pezone et al.
Nucleic acids research, 48(16), 8943-8958 (2020-07-23)
The epithelial-to-mesenchymal transition (EMT) is a complex transcriptional program induced by transforming growth factor β1 (TGF-β1). Histone lysine-specific demethylase 1 (LSD1) has been recognized as a key mediator of EMT in cancer cells, but the precise mechanism that underlies the
Yi Su et al.
BMC cancer, 17(1), 477-477 (2017-07-12)
Jumonji C domain 2A (JMJD2A), as a histone demethylases, plays a vital role in tumorigenesis and progression. But, its functions and underlying mechanisms of JMJD2A in nasopharyngeal carcinoma (NPC) metabolism are remained to be clarified. In this study, we investigated
Tadahiko Nakagawa et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 23(3), 426-436 (2019-11-05)
Jumonji domain-containing protein 2A (JMJD2A) of the JMJD2 family of histone lysine demethylases has been implicated in tumorigenesis. However, its expression and role in gastric cancer (GC) drug resistance remain unknown. Here, we investigated the role of JMJD2A in GC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica