Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU011481

Sigma-Aldrich

MISSION® esiRNA

targeting human PROM1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCGGAAACTGGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCAGAGCAAATCAAATATATATTGGCCCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGAACAGTATCAATTCAGTGCTAGGAGGCGGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCTTGATGAGATTAAGTCCATGGCAACAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTGAATAGCAACCCTGAACTGAGGCAGCTTCCACCCGTGGATGCAGAACTTGACAACGTTAATAACGTTCTTAGGACAGATTTGGATGGCCTGGTCCAACAGGGCTATCAATCC

Ensembl | Número de adesão de ser humano

ENSG00000007062

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PROM1(8842) , PROM1(8842)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HLU
IKU
QCS
TFU
WAU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jong Woo Park et al.
Molecules (Basel, Switzerland), 25(14) (2020-07-12)
The pharmacological effects of BST204-a fermented ginseng extract-on several types of cancers have been reported. However, the effects of ginseng products or single ginsenosides against cancer stem cells are still poorly understood. In this study, we identified the anti-tumorigenic and
Yanli Jin et al.
BMC cancer, 15, 226-226 (2015-04-18)
Acute lymphoblastic leukemia (ALL) is a heterogeneous group of malignant disorders derived from B- or T-cell lymphoid progenitor cells. ALL often is refractory to or relapses after treatment; thus, novel targeted therapy for ALL is urgently needed. In the present
Liang-Yu Lin et al.
Cardiovascular diabetology, 13, 111-111 (2014-07-17)
Circulating endothelial progenitor cells (EPCs) reflect endothelial repair capacity and may be a significant marker for the clinical outcomes of cardiovascular disease. While some high-dose statin treatments may improve endothelial function, it is not known whether different statins may have
Hideki Izumi et al.
Scientific reports, 9(1), 2236-2236 (2019-02-21)
CD133 is a transmembranous protein that mainly localises to the plasma membrane in haematopoietic and neural stem cells as well as cancer stem cells. Although CD133 also localises to the cytoplasm, the mechanism of action and function of cytoplasmic CD133
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica