Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU009621

Sigma-Aldrich

MISSION® esiRNA

targeting human ERRFI1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCAGCTGGCTCCTTTAACAAGCCAGCCATAAGGATATCCAACTGTTGTATACACAGAGCTTCTCCTAACTCCGATGAAGACAAACCTGAGGTTCCCCCCAGAGTTCCCATACCTCCTAGACCAGTAAAGCCAGATTATAGAAGATGGTCAGCAGAAGTTACTTCGAGCACCTATAGTGATGAAGACAGGCCTCCCAAAGTACCGCCAAGAGAACCTTTGTCACCGAGTAACTCGCGCACACCGAGTCCCAAAAGCCTTCCGTCTTACCTCAATGGGGTCATGCCCCCGACACAGAGCTTTGCCCCTGATCCCAAGTATGTCAGCAGCAAAGCACTGCAAAGACAGAACAGCGAAGGATCTGCCAGTAAGGTTCCTTGCATTCTGCCCATTATTGAAAATGGGAAGAAGGTTAGTTCAACACATTATTACCTACTACCTGAACGACCACCATACCTGGACAAATATGAAAAATTTTTTAGGGAAGCAGAAGAAACAAATGGAGGCGCCCAAATCCAGCCATTACCTGCTG

Ensembl | Número de adesão de ser humano

ENSG00000116285

nº de adesão NCBI

NM_018948

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ERRFI1(54206) , ERRFI1(54206)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Da Hyun Kang et al.
BMC cancer, 20(1), 571-571 (2020-06-20)
The resistance of lung cancer to epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is one of the unconquered frontiers in chemotherapy. Mitogen-inducible gene 6 (Mig-6) is known to inhibit the kinase activity of epidermal growth factor receptor (EGFR). Similarly, numerous
Zixuan Li et al.
Experimental and molecular pathology, 102(3), 492-499 (2017-05-17)
The ablation of Mig-6 has been shown to induce tumor formation in various tissues. However, the relationships between Mig-6 expression, clinical pathological factors, and prognosis have not been clarified in hepatocellular carcinoma (HCC), and the mechanism by which Mig-6 regulates
Soyoung Park et al.
Oncotarget, 7(8), 8916-8930 (2016-01-14)
Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional
Malgorzata Milewska et al.
PloS one, 10(6), e0129859-e0129859 (2015-06-13)
BRAF functions in the RAS-extracellular signal-regulated kinase (ERK) signaling cascade. Activation of this pathway is necessary to mediate the transforming potential of oncogenic BRAF, however, it may also cause a negative feedback that inhibits the epidermal growth factor receptor (EGFR).

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica