Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU009531

Sigma-Aldrich

MISSION® esiRNA

targeting human PLA2G4A

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGGCCTTGGTGAGTGATTCAGCTTTATTCAATACCAGAGAAGGACGTGCTGGGAAGGTACACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTGAGTGACTTTGCCACACAGGACTCCTTTGATGATGATGAACTGGATGCAGCTGTAGCAGATCCTGATGAATTTGAGCGAATATATGAGCCTCTGGATGTCAAAAGTAAAAAGATTCATGTAGTGGACAGTGGGCTCACATTTAACCTGCCGTATCCCTTGATACTGAGACCTCAGAGAGGGGTTGATCTCATAATCTCCTTTGACTTTTCTGCAAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAGTGGGCTAAAATGAACAAGCTCCCCTTTCCAAAGATTGATCCTTATGTGTTTGATCGGGAAGGGCTGAAGGAGTGCTATGTCTTTAAACCCAAGAATCCTGATATGGAGAAAGATTGCCCAACCATCATCCACTTTGTTCTGGCCAACATCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chinmoy Sarkar et al.
Autophagy, 16(3), 466-485 (2019-06-27)
Lysosomal membrane permeabilization (LMP) is observed under many pathological conditions, leading to cellular dysfunction and death. However, the mechanisms by which lysosomal membranes become leaky in vivo are not clear. Our data demonstrate that LMP occurs in neurons following controlled
Nikos Koundouros et al.
Cell, 181(7), 1596-1611 (2020-06-20)
Oncogenic transformation is associated with profound changes in cellular metabolism, but whether tracking these can improve disease stratification or influence therapy decision-making is largely unknown. Using the iKnife to sample the aerosol of cauterized specimens, we demonstrate a new mode
Dennis Y Chuang et al.
Journal of neuroinflammation, 12, 199-199 (2015-11-02)
Oxidative stress and inflammation are important factors contributing to the pathophysiology of numerous neurological disorders, including Alzheimer's disease, Parkinson's disease, acute stroke, and infections of the brain. There is well-established evidence that proinflammatory cytokines and glutamate, as well as reactive

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica