Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU008491

Sigma-Aldrich

MISSION® esiRNA

targeting human IL33

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAGTTGATGGAAACCTGTGAGTCTTGGG

Ensembl | Número de adesão de ser humano

ENSG00000137033

nº de adesão NCBI

NM_033439

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IL33(90865) , IL33(90865)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LAV

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Dongmin Shao et al.
Biochemical and biophysical research communications, 451(1), 8-14 (2014-07-09)
Idiopathic pulmonary arterial hypertension (IPAH) is an incurable condition leading to right ventricular failure and death and inflammation is postulated to be associated with vascular remodelling. Interleukin (IL)-33, a member of the "alarmin" family can either act on the membrane
Weronika Gonciarz et al.
International journal of molecular sciences, 21(5) (2020-03-11)
Interleukin (IL)-33 is a proinflammatory mediator that alerts the host immune system to disorders in tissue homeostasis. Aim. To understand the role of IL-33 in modulating gastric tissue cell growth affected by Helicobacter pylori (H. pylori). Methods. IL-33 production in
Meng Li et al.
International journal of molecular sciences, 22(5) (2021-03-07)
Short-chain fatty acids (e.g., butyrate and propionate) are able to diminish endothelial cell activation. The aim of this study was to investigate whether intracellular IL-33 mediates the effects of butyrate and propionate on TNFα-induced IL-8 production and vascular cell adhesion
Haiyan Hu et al.
Biochemical and biophysical research communications, 485(3), 643-650 (2017-02-22)
Breast cancers with estrogen receptor (ER) expressions account for the majority of all clinical cases. Due to hormone therapy with tamoxifen, prognoses of patients with ER-positive breast cancer are significantly improved. However, endocrine resistance to tamoxifen is common and inevitable
Supaporn Yangngam et al.
Journal of Cancer, 11(22), 6571-6581 (2020-10-14)
Interleukin 33 (IL-33) promotes cholangiocarcinoma (CCA) genesis in a mouse model, however, its function in human CCA has not been clearly understood. This study was aimed to investigate IL-33 level in CCA tissues and its clinicopathological correlations. The results revealed
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica