Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU007521

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH8

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAAGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGAAAATGGGAGAAGTTGCAGATGACGTCCA

Ensembl | Número de adesão de ser humano

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shivam Singh et al.
Cancer cell international, 17, 116-116 (2017-12-08)
Herein, for the first time, we report aberrant expression of membrane-associated RING-CH8 (MARCH8) in human esophageal squamous cell carcinoma. MARCH8 is a member of the recently discovered MARCH family of really interesting new genes (RING) E3 ligases. Though initial studies
Shivam Singh et al.
Journal of proteomics, 236, 104125-104125 (2021-02-05)
MARCH8 is an E3 ligase, primarily involved in immune-modulation. Recently, we reported its aberrant expression in human esophageal squamous cell carcinoma. However, exact mechanisms by which it regulates cancer have been poorly understood. We applied high-throughput quantitative proteomics approach to
Sriganesh B Sharma et al.
Molecular and cellular biology, 34(22), 4143-4164 (2014-09-10)
Despite the low prevalence of activating point mutation of RAS or RAF genes, the RAS-extracellular signal-regulated kinase (ERK) pathway is implicated in breast cancer pathogenesis. Indeed, in triple-negative breast cancer (TNBC), there is recurrent genetic alteration of pathway components. Using

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica