Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU004571

Sigma-Aldrich

MISSION® esiRNA

targeting human ASPN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTCCTGGCTTTGTGCTCTGCCAAACCCTTCTTTAGCCCTTCACACATCGCACTGAAGAATATGATGCTGAAGGATATGGAAGACACAGATGATGATGATGATGATGATGATGATGATGATGATGATGATGAGGACAACTCTCTTTTTCCAACAAGAGAGCCAAGAAGCCATTTTTTTCCATTTGATCTGTTTCCAATGTGTCCATTTGGATGTCAGTGCTATTCACGAGTTGTACATTGCTCAGATTTAGGTTTGACCTCAGTCCCAACCAACATTCCATTTGATACTCGAATGCTTGATCTTCAAAACAATAAAATTAAGGAAATCAAAGAAAATGATTTTAAAGGACTCACTTCACTTTATGGTCTGATCCTGAACAACAACAAGCTAACGAAGATTCACCCAAAAGCCTTTCTAACCACAAAGAAGTTGCGAAGG

Ensembl | Número de adesão de ser humano

ENSG00000106819

nº de adesão NCBI

NM_017680

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ASPN(54829) , ASPN(54829)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiao-Li Li et al.
Cell biology international (2019-09-10)
The progression of diabetic cardiomyopathy is related to cardiomyocyte dysfunction and apoptosis. Our previous studies showed that asporin (ASPN) was significantly increased in the myocardium of db/db mice through proteomics, and grape seed procyanidin B2 (GSPB2) significantly inhibited the expression
Hengcun Li et al.
Cell death & disease, 10(2), 109-109 (2019-02-08)
Previous studies revealed that Asporin (ASPN) is a potential mediator in the development of various types of cancer as a secreted stroma protein, but the function of ASPN inside the cancer cells remains largely unknown. Here, we demonstrated a higher

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica