Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU048791

Sigma-Aldrich

MISSION® esiRNA

targeting human GCLC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGCTTCCAAGTCCCTCTTCTTTCCAGATGAAGCAATAAACAAGCACCCTCGCTTCAGTACCTTAACAAGAAATATCCGACATAGGAGAGGAGAAAAGGTTGTCATCAATGTACCAATATTTAAGGACAAGAATACACCATCTCCATTTATAGAAACATTTACTGAGGATGATGAAGCTTCAAGGGCTTCTAAGCCGGATCATATTTACATGGATGCCATGGGATTTGGAATGGGCAATTGCTGTCTCCAGGTGACATTCCAAGCCTGCAGTATATCTGAGGCCAGATACCTTTATGATCAGTTGGCTACTATCTGTCCAATTGTTATGGCTTTGAGTGCTGCATCTCCCTTTTACCGAGGCTATGTGTCAGACATTGATTGTCGCTGGGGAGTGATTTCTGCATCTGTAGATGATAGAACTCGGGAGGAGCGAGGACTGGAGCCATTGAAGAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dulani Wimalachandra et al.
Biochimica et biophysica acta, 1863(1), 71-80 (2017-10-21)
Endometriosis is a disease characterized by regurgitated lesions which are invasive and migratory, embedding at ectopic, extra-uterine locations. Extracellular glucosylceramides (GlcCers), bioactive sphingolipids potentiating signals for cell migration, are found in elevated levels in endometriosis; however underlying mechanisms that result
Preeti Kanikarla-Marie et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(6), 2160-2170 (2015-11-26)
Type 1 diabetic (T1D) patients have a higher incidence of liver disease. T1D patients frequently experience elevated plasma ketone levels along with hyperglycemia. However, no study has examined whether hyperketonemia per se has any role in excess liver damage in
Arunkumar E Achari et al.
Archives of biochemistry and biophysics, 630, 54-65 (2017-08-02)
Diabetic patients have lower blood levels of l-cysteine (LC) and glutathione (GSH). This study examined the hypothesis that LC supplementation positively up regulates the effects of insulin on GSH and glucose metabolism in 3T3-L1 adipocyte model. 3T3L1 adipocytes were treated
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique