Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU008661

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45GIP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTAAGCAGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGGAGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGCAGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGCACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGCGGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGGCCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCCAGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGGAGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCACCCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Harsha Nagar et al.
Antioxidants & redox signaling, 27(4), 234-249 (2017-01-25)
Mitochondrial dysfunction has emerged as a major contributing factor to endothelial dysfunction and vascular disease, but the key mechanisms underlying mitochondrial dysfunction-induced endothelial dysfunction remain to be elucidated. In this study, we aim at determining whether mitochondrial dysfunction in endothelial
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Hulin Chang et al.
Cell death & disease, 11(5), 332-332 (2020-05-10)
CR6-interacting factor 1 (Crif1) is a mitochondrial protein which is required for the assembly of oxidative phosphorylation (OXPHOS) complexes. Our bioinformatics analysis based on Cancer Genome Atlas (TCGA) database revealed an aberrant overexpression of CRIF1 in hepatocellular carcinoma (HCC). However
Min Joung Lee et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1546-1561 (2020-01-29)
Cerebral endothelial cells (ECs) require junctional proteins to maintain blood-brain barrier (BBB) integrity, restricting toxic substances and controlling peripheral immune cells with a higher concentration of mitochondria than ECs of peripheral capillaries. The mechanism underlying BBB disruption by defective mitochondrial
Runzhou Zhuang et al.
Oncotarget, 8(55), 94759-94768 (2017-12-08)
CR6-interacting factor 1 (CRIF1) regulates cell cycle progression and the DNA damage response. Here, we show that CRIF1 expression is decreased in hepatocellular carcinoma (HCC) tissues and positively correlates with patients' survival.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique