Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU155921

Sigma-Aldrich

MISSION® esiRNA

targeting human LOX

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCCAAAGAGTGAAAAACCAAGGGACATCAGATTTCTTACCCAGCCGACCAAGATATTCCTGGGAATGGCACAGTTGTCATCAACATTACCACAGTATGGATGAGTTTAGCCACTATGACCTGCTTGATGCCAACACCCAGAGGAGAGTGGCTGAAGGCCACAAAGCAAGTTTCTGTCTTGAAGACACATCCTGTGACTATGGCTACCACAGGCGATTTGCATGTACTGCACACACACAGGGATTGAGTCCTGGCTGTTATGATACCTATGGTGCAGACATAGACTGCCAGTGGATTGATATTACAGATGTAAAACCTGGAAACTATATCCTAAAGGTCAGTGTAAACCCCAGCTACCTGGTTCCTGAATCTGACTATACCAACAATGTTGTGCGCTGTGACAT

Ensembl | Human Hinterlegungsnummer

ENSG00000113083

NCBI-Hinterlegungsnummer

NM_002317

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LOX(4015) , LOX(4015)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

T Osawa et al.
British journal of cancer, 109(8), 2237-2247 (2013-09-21)
Molecules that are highly expressed in tumour endothelial cells (TECs) may be candidates for specifically targeting TECs. Using DNA microarray analysis, we found that the lysyl oxidase (LOX) gene was upregulated in TECs compared with its expression in normal endothelial
Roozbeh Khosravi et al.
PloS one, 9(6), e100669-e100669 (2014-06-28)
Lysyl oxidase is a multifunctional enzyme required for collagen biosynthesis. Various growth factors regulate lysyl oxidase during osteoblast differentiation, subject to modulation by cytokines such as TNF-α in inflammatory osteopenic disorders including diabetic bone disease. Canonical Wnt signaling promotes osteoblast
Roseli da Silva et al.
PloS one, 10(3), e0119781-e0119781 (2015-03-20)
Lysyl oxidase (LOX) is involved in vital biological processes such as cell motility, cell signaling and gene regulation. Deregulation of this protein can contribute to tumor formation and progression. Although it is known that LOX is involved in invasion, proliferation
Rolf Schreckenberg et al.
Frontiers in physiology, 8, 556-556 (2017-08-22)
Purpose: According to the current therapeutic guidelines of the WHO physical activity and exercise are recommended as first-line therapy of arterial hypertension. Previous results lead to the conclusion, however, that hearts of spontaneously hypertensive rats (SHR) with established hypertension cannot
D H Peng et al.
Oncogene, 36(14), 1925-1938 (2016-10-04)
Lung cancer is the leading cause of cancer-related deaths, primarily due to distant metastatic disease. Metastatic lung cancer cells can undergo an epithelial-to-mesenchymal transition (EMT) regulated by various transcription factors, including a double-negative feedback loop between the microRNA-200 (miR-200) family
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.