Direkt zum Inhalt
Merck

EHU151981

Sigma-Aldrich

MISSION® esiRNA

targeting human HIF1A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Klaartje Somers et al.
Oncogene, 38(20), 3824-3842 (2019-01-24)
Survival rates for pediatric patients suffering from mixed lineage leukemia (MLL)-rearranged leukemia remain below 50% and more targeted, less toxic therapies are urgently needed. A screening method optimized to discover cytotoxic compounds selective for MLL-rearranged leukemia identified CCI-006 as a
Shu Lou et al.
Frontiers in cell and developmental biology, 8, 576-576 (2020-08-09)
Although genetic variants in autophagy pathway genes were associated with the risk of oral cancers and early development in embryos, their associations with non-syndromic cleft lip with or without cleft palate (NSCL/P) risk remained unclear. A two-stage case-control study (2,027
Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Matilda Munksgaard Thorén et al.
Oncotarget, 8(30), 48983-48995 (2017-04-22)
We previously demonstrated that small cell lung carcinoma (SCLC) cells lack HIF-2α protein expression, whereas HIF-1α in these cells is expressed at both acute and prolonged hypoxia. Here we show that low HIF2A expression correlates with high expression of MYC
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.