Direkt zum Inhalt
Merck

EHU143641

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACACCTGGACCGAGTTTGTGGAGGGAAAGAATAAGACTGTGAGCAAGCTGGTGATCCAGAATGCCAACGTGTCTGCCATGTACAAGTGTGTGGTCTCCAACAAGGTGGGCCAGGATGAGCGGCTCATCTACTTCTATGTGACCACCATCCCCGACGGCTTCACCATCGAATCCAAGCCATCCGAGGAGCTACTAGAGGGCCAGCCGGTGCTCCTGAGCTGCCAAGCCGACAGCTACAAGTACGAGCATCTGCGCTGGTACCGCCTCAACCTGTCCACGCTGCACGATGCGCACGGGAACCCGCTTCTGCTCGACTGCAAGAACGTGCATCTGTTCGCCACCCCTCTGGCCGCCAGCCTGGAGGAGGTGGCACCTGGGGCGCGCCACGCCACGCTCAGCCTGAGTATCCCCCGCGTCGCGCCCGAGCACGAGGGCCACTATGTGTGCGAAGTGCAAGACCGGCGCAGCCATGACAAGCACTGCCACAAGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Joo-Hee Park et al.
PloS one, 9(9), e109055-e109055 (2014-10-01)
MAZ51 is an indolinone-based molecule originally synthesized as a selective inhibitor of vascular endothelial growth factor receptor (VEGFR)-3 tyrosine kinase. This study shows that exposure of two glioma cell lines, rat C6 and human U251MG, to MAZ51 caused dramatic shape
Yan Zhang et al.
Nature communications, 9(1), 1296-1296 (2018-04-05)
Incomplete delivery to the target cells is an obstacle for successful gene therapy approaches. Here we show unexpected effects of incomplete targeting, by demonstrating how heterogeneous inhibition of a growth promoting signaling pathway promotes tissue hyperplasia. We studied the function
Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
Raj Kumar et al.
Cell death & disease, 11(5), 325-325 (2020-05-10)
Pathological retinal neovascularization is the most common cause of vision loss. PKCθ has been shown to play a role in type 2 diabetes, which is linked to retinal neovascularization. Based on these clues, we have studied the role of PKCθ

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.