Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU123831

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAATGACCTCTCCATCGTCAACCCTGCTCGCAAGGGCCTCTACGAGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGGAGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTGACAAGAGGGACATCTCGCGATTTCTCGAGTCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAGGATAGCCAAGTTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAG

Ensembl | Human Hinterlegungsnummer

ENSG00000119772

NCBI-Hinterlegungsnummer

NM_022552

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... DNMT3A(1788) , DNMT3A(1788)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yu Nomura et al.
Cells, tissues, organs, 207(3-4), 115-126 (2019-10-02)
Stem cells have essential applications in in vitro tissue engineering or regenerative medicine. However, there is still a need to understand more deeply the mechanisms of stem cell differentiation and to optimize the methods to control stem cell function. In
Xi Han et al.
Cell biology international, 45(1), 227-237 (2020-10-23)
Emerging evidence suggests that miR-143 plays an important role in the regulation of tumor sensitivity to chemotherapeutic agents. The study explores the underlying mechanism of miR-143 in reversing cisplatin resistance in ovarian cancer. The cisplatin-resistant ovarian cancer cell line A2780/CDDP
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Li Zhang et al.
Cancer cell international, 20, 325-325 (2020-07-24)
Methylation of histone 3 at lysine 9 (H3K9) and DNA methylation are epigenetic marks correlated with genes silencing. The tumor microenvironment significantly influences therapeutic responses and clinical outcomes. The epigenetic-regulation mechanism of the costimulatory factors Tim-3 and galectin-9 in cervical
Anjin Wang et al.
Oncology letters, 21(4), 272-272 (2021-03-16)
Cervical cancer is the second most common gynecological malignancy. Accumulating evidence has suggested that microRNAs (miRNAs) are involved in the occurrence and development of cervical cancer. The present study aimed to investigate the function and underlying molecular mechanism of microRNA
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.