Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU079921

Sigma-Aldrich

MISSION® esiRNA

targeting human MCL1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

Ensembl | Human Hinterlegungsnummer

ENSG00000143384

NCBI-Hinterlegungsnummer

NM_021960

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MCL1(4170) , MCL1(4170)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Yuzu Zhao et al.
Cell death & disease, 8(10), e3133-e3133 (2017-10-27)
Demethylzeylasteral is one of the extracts of Tripterygium wilfordii Hook F, which plays important roles in multiple biological processes such as inflammation inhibition, as well as immunosuppression. However, anti-cancer function and the underlying mechanisms of demethylzeylasteral in melanoma cells remain
Takahito Sugase et al.
Cancer research, 77(24), 6975-6986 (2017-10-19)
STAT3 has been implicated recently in radioresistance in cancer. In this study, we investigated the association between STAT3 and radioresistance in esophageal squamous cell carcinoma (ESCC). Strong expression of activated phospho-STAT3 (p-STAT3) was observed in 16/22 ESCC patients with preoperative
Yuto Yasuda et al.
Cell death & disease, 11(3), 177-177 (2020-03-11)
There have been few advances in the treatment of small-cell lung cancer (SCLC) because of the lack of targets. MCL1, a member of the anti-apoptotic BCL-2 family, may be a treatment target in several cancers, including SCLC. However, whether the
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.