Direkt zum Inhalt
Merck

EHU075421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAGGCATTGGTGAAGACAAAATGGCCTCGCCGGCTGACAGCTGTATCCAGTTCACCCGCCATGCCAGTGATGTTCTTCTCAACCTTAATCGTCTCCGGAGTCGAGACATCTTGACTGATGTTGTCATTGTTGTGAGCCGTGAGCAGTTTAGAGCCCATAAAACGGTCCTCATGGCCTGCAGTGGCCTGTTCTATAGCATCTTTACAGACCAGTTGAAATGCAACCTTAGTGTGATCAATCTAGATCCTGAGATCAACCCTGAGGGATTCTGCATCCTCCTGGACTTCATGTACACATCTCGGCTCAATTTGCGGGAGGGCAACATCATGGCTGTGATGGCCACGGCTATGTACCTGCAGATGGAGCATGTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Britta Jasmer et al.
Oncotarget, 8(65), 108643-108654 (2018-01-10)
The oncogene B-cell lymphoma 6 (BCL6) is associated with lymphomagenesis. Intriguingly, its expression is increased in preeclamptic placentas. Preeclampsia is one of the leading causes of maternal and perinatal mortality and morbidity. Preeclamptic placentas are characterized by various defects like
Marie-Sophie Fabre et al.
PloS one, 15(4), e0231470-e0231470 (2020-04-23)
The prognosis for people with the high-grade brain tumor glioblastoma is very poor, due largely to low cell death in response to genotoxic therapy. The transcription factor BCL6, a protein that normally suppresses the DNA damage response during immune cell
Min Gao et al.
Aging, 12(10), 9275-9291 (2020-05-16)
Nucleus accumbens-associated protein 1 (NAC1) has multifaceted roles in cancer pathogenesis and progression, including the development of drug resistance, promotion of cytokinesis, and maintenance of "stem cell-like" phenotypes. NAC1 is a transcriptional co-regulator belonging to the bric-a-brac tramtrack broad (BTB)
Andreas Ritter et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Human placentation is a highly invasive process. Deficiency in the invasiveness of trophoblasts is associated with a spectrum of gestational diseases, such as preeclampsia (PE). The oncogene B-cell lymphoma 6 (BCL6) is involved in the migration and invasion of various
Siraj M El Jamal et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 539-550 (2018-11-18)
Myocyte enhancer-binding factor 2B (MEF2B) has been implicated as a transcriptional regulator for BCL6. However, details about the interaction between MEF2B and BCL6 during expression, as well as the relationship of MEF2B to the expression of other germinal center (GC)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.