Direkt zum Inhalt
Merck

EHU061411

Sigma-Aldrich

MISSION® esiRNA

targeting human PLXNB2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTTCTTCCTGCCCTCCAAGGACGGCGACAAGGACGTGATGATCACCGGCAAGCTGGACATCCCTGAGCCGCGGCGGCCGGTGGTGGAGCAGGCCCTCTACCAGTTCTCCAACCTGCTGAACAGCAAGTCTTTCCTCATCAATTTCATCCACACCCTGGAGAACCAGCGGGAGTTCTCGGCCCGCGCCAAGGTCTACTTCGCGTCCCTGCTGACGGTGGCGCTGCACGGGAAACTGGAGTACTACACGGACATCATGCACACGCTCTTCCTGGAGCTCCTGGAGCAGTACGTGGTGGCCAAGAACCCCAAGCTGATGCTGCGCAGGTCTGAGACTGTGGTGGAGAGGATGCTGTCCAACTGGATGTCCATCTGCCTGTACCAGTACCTCAAGGACAGTGCCGGGGAGCCCCTGTACAAGCTCTTCAAGGCCATCAAACATCAGGTGGAAAAGGGCCCGGTGGATGCGGTACAGAAGAAGGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Brad McColl et al.
Journal of cell science, 129(21), 4046-4056 (2016-11-03)
Rnd proteins are atypical members of the Rho GTPase family that induce actin cytoskeletal reorganization and cell rounding. Rnd proteins have been reported to bind to the intracellular domain of several plexin receptors, but whether plexins contribute to the Rnd-induced
Ying Zhang et al.
Cellular signalling, 62, 109343-109343 (2019-06-10)
Plexin-B2 (PLXNB2), a transmembrane protein is found in various tissues. Recent studies have indicated the presence of PLXNB2 in large quantity in the growth plates of Sprague-Dawley rats and are believed to be potentially involved in their skeletal development. This
Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.