Direkt zum Inhalt
Merck

EHU053891

Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Pankaj Prasad et al.
Stem cells (Dayton, Ohio), 35(6), 1468-1478 (2017-04-05)
Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a
Xiaoli Peng et al.
BMC cancer, 17(1), 619-619 (2017-09-06)
Breast cancer is the common cancer in China. In previous study, we determined that 3,6-dihydroxyflavone (3,6-DHF) increases miR-34a significantly in breast carcinogenesis, but the mechanism remains unclear. We used qRT-PCR to analyze miR-34a and ten-eleven translocation (TET)1, TET2, TET3 levels
Ryan J Marina et al.
The EMBO journal, 35(3), 335-355 (2015-12-30)
Intragenic 5-methylcytosine and CTCF mediate opposing effects on pre-mRNA splicing: CTCF promotes inclusion of weak upstream exons through RNA polymerase II pausing, whereas 5-methylcytosine evicts CTCF, leading to exon exclusion. However, the mechanisms governing dynamic DNA methylation at CTCF-binding sites

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.