Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU033071

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAG

Ensembl | Human Hinterlegungsnummer

ENSG00000105810

NCBI-Hinterlegungsnummer

NM_001259

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CDK6(1021) , CDK6(1021)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Míriam Tarrado-Castellarnau et al.
Molecular systems biology, 13(10), 940-940 (2017-10-06)
Cyclin-dependent kinases (CDK) are rational cancer therapeutic targets fraught with the development of acquired resistance by tumor cells. Through metabolic and transcriptomic analyses, we show that the inhibition of CDK4/6 leads to a metabolic reprogramming associated with gene networks orchestrated
Tao Gong et al.
Aging, 12(12), 12086-12106 (2020-06-26)
Emerging studies indicate that long non-coding RNAs (lncRNAs) play crucial roles in colorectal cancer (CRC). Here, we reported lncRNA CASC21, which is induced by FOXP1, functions as an oncogene in CRC. We systematically elucidated its clinical significance and possible molecular
Lihua Guo et al.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 787-794 (2018-07-14)
Clear cell renal cell carcinoma (ccRCC) accounts for 70-80% of renal cell carcinomas. Various microRNAs (miRs) have been reported to affect the tumorigenesis of ccRCC. However, the role of miR-384 in ccRCC is still unknown. Thus, the purpose of this
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.