Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

Ensembl | human accession no.

ENSG00000157554

NCBI accession no.

NM_182918

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ERG(2078) , ERG(2078)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Chun-Wu Pan et al.
Theranostics, 11(4), 1780-1794 (2021-01-08)
Rationale: Enhancer RNA (eRNA) bi-directionally expresses from enhancer region and sense eRNA regulates adjacent mRNA in cis and in trans. However, it has remained unclear whether antisense eRNAs in different direction are functional or merely a reflection of enhancer activation.
Abdullah A Assiri et al.
Cancer genomics & proteomics, 16(6), 433-442 (2019-10-30)
hERG potassium channels enhance tumor invasiveness and breast cancer proliferation. MicroRNA (miRNA) dysregulation during cancer controls gene regulation. The objective of this study was to identify miRNAs that regulate hERG expression in breast cancer. Putative miRNAs targeting hERG were identified
Ahmed A Mohamed et al.
Molecular cancer research : MCR, 15(10), 1308-1317 (2017-06-14)
The oncogenic activation of the ETS-related gene (
Jung-Sun Kim et al.
Endocrinology, 155(9), 3262-3273 (2014-06-14)
A number of preclinical studies have shown that the activation of the vitamin D receptor (VDR) reduces prostate cancer (PCa) cell and tumor growth. The majority of human PCas express a transmembrane protease serine 2 (TMPRSS2):erythroblast transformation-specific (ETS) fusion gene
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service