Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHURLUC

Sigma-Aldrich

MISSION® esiRNA

targeting RLUC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

shipped in

ambient

storage temp.

−20°C

General description

EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Other Notes

esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Jonasz J Weber et al.
Human molecular genetics, 29(6), 892-906 (2020-01-22)
Proteolytic fragmentation of polyglutamine-expanded ataxin-3 is a concomitant and modifier of the molecular pathogenesis of Machado-Joseph disease (MJD), the most common autosomal dominant cerebellar ataxia. Calpains, a group of calcium-dependent cysteine proteases, are important mediators of ataxin-3 cleavage and implicated
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results

Artículos

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico