Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033701

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chen Yan et al.
Cancer letters, 388, 34-42 (2016-12-04)
Cancer stem cells (CSCs) are known to be drug resistant. Mitophagy selectively degrades unnecessary or damaged mitochondria by autophagy during cellular stress. To investigate the potential role of mitophagy in drug resistance in CSCs, we purified CD133
Sajid Naeem et al.
Toxicology letters, 326, 1-10 (2020-03-07)
Our previous study demonstrated that cadmium (Cd) is an effective inducer of mitophagy, which is mainly mediated by PINK1/Parkin pathway. However, the role of other mitophagy pathways in Cd-induced mitophagy remains elusive. The present study employed HeLa cells, lacking fully
Dan Xu et al.
American journal of physiology. Renal physiology, 316(2), F382-F395 (2018-09-13)
Proteinuria, the most common symptom of renal injury, is an independent factor for renal tubular injury. However, the underlying mechanism remains to be fully elucidated. Mitochondrion is an important target for proteinuria-induced renal tubular cell injury. Insufficient mitophagy exacerbates cell
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico