Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHUFLUC

Sigma-Aldrich

MISSION® esiRNA

targeting FLUC

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

shipped in

ambient

storage temp.

−20°C

General description

EHUFLUC targets Firefly Luciferase. It can be used as a negative control in systems lacking Firefly Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Other Notes

esiRNA cDNA target sequence: GAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATT

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Laura Lee et al.
PloS one, 14(5), e0213116-e0213116 (2019-05-22)
The mitochondrial outer membrane protein Mitochondrial Fission Factor (Mff) plays a key role in both physiological and pathological fission. It is well established that at stressed or functionally impaired mitochondria, PINK1 recruits the ubiquitin ligase Parkin which ubiquitinates Mff and
Ann Hammarstedt et al.
Scientific reports, 8(1), 15757-15757 (2018-10-27)
Adipose tissue dysfunction is considered an important contributor to systemic insulin resistance and Type 2 diabetes (T2D). Recently, a novel family of endogenous lipids, palmitic acid hydroxy stearic acids (PAHSAs), was discovered. These have anti-diabetic and anti-inflammatory effects in mice
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Theodora Saridaki et al.
Journal of neurochemistry, 146(4), 474-492 (2018-05-11)
Parkinson's disease can be caused by mutations in the α-synuclein gene and is characterized by aggregates of α-synuclein protein. We have previously shown that over-expression of the small GTPase Rab7 can induce clearance of α-synuclein aggregates. In this study, we
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico