MLMIR2011

MISSION^® Lenti microRNA, Mouse

mmu-miR-7686-3p

• NACRES: NA.51
• UNSPSC Code: 41106609
• Concentration: ≥1x10⁶ VP/ml (via p24 assay)
• Mature sequence: CUGCUCGGGGCACUGUAAGAGA

Właściwości

• product line: MISSION^®
• form: liquid
• concentration: ≥1x10⁶ VP/ml (via p24 assay)
• mature sequence: CUGCUCGGGGCACUGUAAGAGA
• Sanger mature/minor accession no.: MIMAT0029899
• Sanger microRNA accession no.: MI0025037
• shipped in: dry ice
• storage temp.: −70°C

Opis

General description

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Other Notes

Based on miRBase V20 Mature ID

Two negative controls are available: NCLMIR001 and NCLMIR002

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Ta strona może zawierać tekst przetłumaczony maszynowo.

Informacja o środkach bezpieczeństwa

• Klasa składowania: 12 - Non Combustible Liquids
• wgk: WGK 3
• flash_point_f: Not applicable
• flash_point_c: Not applicable